HM Medical Clinic

18 the yukon old crow helicobacter pylori infection project

The Yukon Old Crow Helicobacter pylori Infection Project
The First Report on the Prevalence and Epidemiology of Helicobacter pylori in
Sander Veldhuyzen van Zanten, Laura Aplin, Amy L. Morse, John W. Morse, Monika M.
Keelan, Janis Geary, Brendan Hanley, Diane M. Kirchgatter, Wendy Balsillie, Karen J.
Dorji Dorji, Tashi D. Wangdi, Hoda M. Malaty, Kinley Wangchuk, Deki Yangzom, James Background: Helicobacter pylori infection has been a growing community health concern in Background: The epidemiology of Helicobacter pylori infection and risk factors associated northern Canada. Both H. pylori prevalence and stomach cancer rates are elevated in Arctic with in Bhutan are not previously studied. The World Health Organization reported the Aboriginal populations. This project arose as part of the Canadian North Helicobacter pylori incidence of stomach cancer to be very high in Bhutan. Bhutan is small mountainous country (CANHelp) Working Group addressing health concerns raised by residents of Old Crow, bordering India and China and consists of four geographical regions, west, east, central, Yukon (population=250, 90% Aboriginal). It was approved by the Vuntut Gwitchin General and south. Aim: We conducted a cross-sectional study to determine the seroepidemiologic Assembly. This project was designed and conducted in collaboration with a local planning pattern of H. pylori among Bhutanese from the four regions with emphasis on water source committee. Purpose: to investigate the disease burden related to H. pylori infection and and household sanitation. Methods: Between June and November 2012, blood sample from identify strategies for reducing health-related risks in Old Crow. Methods: During 2010 and patients with complaints of dyspepsia and blood donors were collected after an informed 2011, all 250 residents of Old Crow were invited to be screened for H. pylori infection by consent. Demographic information, occupation, family size living in the same household, UBT and interviewed using structured questionnaires. All residents of Old Crow, who gave consumption of betel nut, and aspects household environment including type of latrines, informed consent, were eligible. In 2012, all residents were invited to undergo endoscopy source of drinking water were collected. All serum samples were tested for H. pylori Immunog- with gastric biopsy, in temporary endoscopy units in the Old Crow Health Centre. Participants lobin G (IgG) by Enzyme Linked Immuno-sorbent Assay (ELISA) using MAGIWELL ELISA ≥15 years of age could also enrol in a treatment trial comparing two 10 day H. pylori kit from United Biotec, USA. Results: Two hundred forty four patients between the ages of therapies: sequential therapy consisted of a proton pump inhibitor and amoxicillin for days 17 and 75 years participated in the study; 102 males, and the mean age was 38 (+ 14.2) 1-5, followed by a proton pump inhibitor, clarithromycin and metronidazole for days 6- years. The overall prevalence of H.pylori among patients was 86% with no difference between 10; quadruple therapy consisted of a proton pump inhibitor with bismuth, metronidazole, males and females (90% vs. 83%, respectively, p=0.12). The prevalence was almost identical and tetracycline for days 1-10. Follow-up UBT was used to determine the success of therapy among all age groups; 81% at age 17-20, 84% (20-29), 93% (30-39), 82% (40-49), 87% Results: From November 2010 to August 2012, 199 residents consented to participate, (50-59) and 82% at .60 years (p=0.51). H. pylori prevalence was lower in the south region ages ranged from 1-88 years. Of the 199 participants, 145 completed questionnaire-based of Bhutan (78%) compared to the central region (97%) (OR=8.6; 95%CI=1.1-55; p=0.02), interviews, 192 underwent a UBT (UBT positivity=68%), 65 consented to upper gastrointesti- Eastern region (91%) (OR=2.7; 95%CI=1.1-7.2, p=0.004) or the western region (83%) (OR= nal endoscopy, 63 had biopsies collected for culture and histopathology, 86 consented to 1.4, 95% CI=0.8-3.1, p=0.07). Crowding showed no significant effect on H. pylori prevalence treatment, and 70 enrolled in the treatment trial. For histology results see Table. Antibiotic as well as source of drinking water, type of occupation, type of latrines or consumption of resistance frequencies from 53 participants with successful culture were as follows: 42% for betel nut. When logistic regression analysis was applied with all the variables in the model, metronidazole, 25% for clarithromycin, 8% for ciprofloxacin, 2% (borderline) for tetracycline, the residing region was the only variable was emerged to be significant. The prevalence and 0 for amoxicillin, nitrofurantoin, and rifampicin. Treatment trial preliminary results: among blood donors was less than the prevalence among the studied patients (76% vs.
sequential therapy, treatment success 60% (12/20; 95% confidence interval 36%-81%), 86%, OR=1.9; 95%CI=1.2-3.2; p=0.01). However, that prevalence was almost identical quadruple therapy 85% (17/20; 95% confidence interval 62%-97%). This difference suggests across all age groups. Conclusions: The high prevalence of antibodies to H. pylori among superiority of quadruple therapy. Discussion: Old Crow residents have a high prevalence patients and volunteers in all groups could contribute to the high incident rate of gastric of H. pylori infection, and gastritis is severe. Quadruple therapy is better than sequential cancer in Bhutan. The lowest prevalence in southern part of the country could be due to therapy. The success of the Old Crow H. pylori Project, as demonstrated by the high level its tropical whether or due to the difference in the ethnicity as most of its population are of participation, is a result of close partnership with the local planning committee and of Indian and Nepal origin. Further data regarding H. pylori infection in Bhutan are critical ongoing community engagement.
to understanding the epidemiology of the infection and to developing surveillance and Results histology gastric biopsies prevention strategies for gastric cancer.
Caspase 8 Maintains Epithelial Cell Adhesion and Intestinal Homeostasis In
Vivo Through Regulation of Clathrin-Dependent Endocytosis and Autophagy
Guillaume Pineton de Chambrun, Carolin F. Manthey, Christopher S. McAllister, Andreas
Till, Martin F. Kagnoff, Pierre Desreumaux, Dwayne Stupack, Jean Y. Wang, Lars
Eckmann
Background: Caspase 8 is a key mediator of ligand-activated apoptosis, but has otherfunctions, including regulation of endocytosis in epithelial cells. The physiological importance of these different activities is poorly understood. The aim of this study was to study thephysiological functions of caspase 8 in intestinal epithelial cells (IECs). Methods: We gener- Does Drinking and Environmental Water Play a Role As a Reservoir in
ated mice specifically lacking Casp8 in IECs (Casp8 ∆IEC) by crossing Casp8fl/fl mice to Helicobacter pylori Transmission? Evidence From the South Region of Poland
Tg(Vil-cre) mice, and examined them for cell death and endocytosis under constitutive and Aneta Targosz, Malgorzata Plonka, Agata Ptak-Belowska, Urszula Szczyrk, Malgorzata challenge conditions. The role of TNF-dependent signaling and autophagy was tested by Strzalka, Tomasz Brzozowski additional ablation of Tnfr1 (Casp8∆IEC/Tnfr1-/-) or Atg7 in IECs (Casp8∆IEC/Atg7∆IEC).
Results: At 6 weeks Casp8 ∆IEC mice did not present any macroscopic or microscopic The main transmission pathway of Helicobacter pylori (Hp) has not been so far identified intestinal abnormalities compared with Casp8fl/fl mice. However, IEC from Casp8 ∆IEC but recent evidence suggests that the waterborne aspect of Hp transmission. We conducted mice lacked the normal constitutive degradation of proteins important for clathrin-dependent the innovative project in Poland aimed to detect the presence of Hp in drinking water endocytosis. To examine the consequences of this disturbance in endocytosis, we infected samples in Cracow and surroundings, because there has not been any research conducted mice with the murine attaching/effacing pathogen, C. rodentium. Casp8 ∆IEC mice displayed in polish population concerning such topic. One hundred twenty nine water samples from significantly more weight loss and mortality than Casp8fl/fl mice after infection. Microscopi- different municipal water distribution system, rivers, drinking water tanks and wells were cally, Casp8∆IEC mice presented a complete destruction of small intestinal villi and ileitis.
collected and analyzed between June and October of 2012. Samples of 1000 mL of water Furthermore, stimulation of Casp8∆IEC mice with LPS for 4 hours caused marked detach- were concentrated by centrifugation. Obtained pellet was resuspended in 1 ml of PBS used ment of small intestine IECs and led to villus destruction and mucosal inflammation.
for the Hp culture and remaining portion was stored at -20°C for DNA extraction and Immunofluorescence analysis revealed disappearance of basal β1-integrin in IECs of Cas- subsequent gastric colonization of Mongolian gerbils. Water samples were subjected to PCR p8∆IEC mice after LPS stimulation, suggesting active endocytosis of adhesion molecules.
for the presence of Hp using primer pair: Cluster2: GGCGTTATCAACAGAATGGC and Consistent with this, LPS-induced IEC detachment was prevented in Casp8 ∆IEC mice treated B1J99: CTCAGTTCGGATTGTAGGCTGC targeting the hypervariable region flanking the with the endocytosis inhibitor chlorpromazine. LPS-induced IEC detachment was prevented 16S rRNA gene in Hp. All samples were negative for Hp culture but twelve out of hundred in Casp8∆IEC/Tnfr1-/- mice, demonstrating a role of TNF α in these events. Furthermore, twenty nine samples collected from the Cracow municipal water distribution system were Casp8∆IEC mice treated with LPS showed abnormal autophagic activation in IECs compared Hp DNA positive. These Hp positive samples unsuccessfully colonized the stomach of to Casp8fl/fl mice, and IEC detachment was absent in Casp8 ∆IEC/Atg7∆IEC mice. Cas- Mongolian gerbils. Among twelve samples which were tested twice (June and October), p8∆IEC/Atg7∆IEC mice were also protected from intestinal inflammation induced by C.
eight were positive only in June, but not in October. We conclude that 1) Hp DNA but not rodentium. Conclusions: Caspase 8 controls IECs adhesion and maintains intestinal barrier viable Hp could be detectable in municipal drinking water samples; 2) water bacteria became integrity in response to infectious stimuli by regulating clathrin-dependent endocytosis and non-culturable by traditional methods from envinromental source such as water and it also autophagy. This work demonstrates a major physiologic role of caspase 8 in maintaining failed to colonize animal stomach possibly due to bug transition from spiral to its coccoid intestinal homeostasis and controlling intestinal inflammation.
and U-shaped forms in aqueous envinroment, and 3) water Hp DNA detection could beinfluenced by the variation of temperature at different seasons (work supported by grantNo 2011/01/B/NZ/01539 to M.K.).
Goblet Cells Deliver Luminal Retinoids and Imprint CD103+ Lamina Propria
Dendritic Cells
Keely G. McDonald, Leroy W. Wheeler, Kathryn Knoop, Miller J. Miller, Rodney D.
Newberry
The small intestine lamina propria (LP) underlies the absorptive villous epithelia and containsa significant population of CD103+ myeloid (CD11b+, CD11c+, MHCII+) DCs. Throughthe generation of the biologically active vitamin A metabolite all-trans retinoic acid (ATRA),

Source: http://www.canhelpworkinggroup.ca/downloads/publications_44_2292326099.pdf