HM Medical Clinic

 

Npgrj_nbt_1481 1.8

A small molecule enhances RNA interference andpromotes microRNA processing Ge Shan1,6, Yujing Li1,6, Junliang Zhang2, Wendi Li1, Keith E Szulwach1, Ranhui Duan1,Mohammad A Faghihi3, Ahmad M Khalil3, Lianghua Lu2, Zain Paroo4, Anthony W S Chan1,Zhangjie Shi5, Qinghua Liu4, Claes Wahlestedt3, Chuan He2 & Peng Jin1 Small interfering RNAs (siRNAs) and microRNAs (miRNAs) are sequence-specific post-transcriptional regulators of geneexpression. Although major components of the RNA interference (RNAi) pathway have been identified, regulatory mechanismsfor this pathway remain largely unknown. Here we demonstrate that the RNAi pathway can be modulated intracellularly by smallmolecules. We have developed a cell-based assay to monitor the activity of the RNAi pathway and find that the small-molecule enoxacin (Penetrex) enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Weshow that this RNAi-enhancing activity depends on the trans-activation-responsive region RNA-binding protein. Our results provide a proof-of-principle demonstration that small molecules can be used to modulate the activity of the RNAi pathway. RNAienhancers may be useful in the development of research tools and therapeutics.
RNAi is a well-conserved mechanism that uses small noncod- ing RNAs to silence gene expression post-transcriptional A chemical screen to identify small molecules that enhance RNAi Gene regulation by RNAi has been recognized as one of the major To alter the activity and gain insight into the regulation of the RNAi regulatory pathways in eukaryotic cellThe endogenous small pathway, we developed a reporter system to monitor RNAi activity.
RNAs can shape diverse cellular pathways, including chromo- In this system, a stable cell line derived from human embryonic some architecture, development, growth control, apoptosis and stem kidney (HEK293) cells, expressing a gene encoding 293-EGFP lishing Gr
(enhanced green fluorescent protein), was infected with a lentivirus RNAi operates via two post-transcriptional mechanisms: targeted expressing a short hairpin RNA (shRNA) that is processed into siRNA mRNA degradation by siRNA and suppression of translation/degrada- specifically targeting EGFP mRNA (Fig. 1a)The transduction led to tion by miRNA. The RNAi mechanism has been co-opted by reduced levels of EGFP in 293-EGFP cells; these cells are called RNAi- researchers and has achieved broad utility in gene-function analysis, 293-EGFP in the experiments following. To verify that the siRNAs drug-target discovery and validation, and therapeutic developmen against EGFP reduced EGFP expression, we transfected the clones with 2008 Nature Pub
Given the pivotal roles of endogenous small RNAs in diverse biological 2-O-methyl-RNAs, which has been shown to block the activity of the pathways and the broad application of RNAi in biology and lentivirus-encoded EGFP siRNAand we observed increased GFP medicine, understanding the mechanism of the RNAi pathway is of expression (Fig. 1a). To reduce variation between experiments, we great importance.
isolated individual cell clones with moderate reductions in GFP Over the last several years, key protein components involved expression and used them to screen for both inhibitors and enhancers in the RNAi pathway have been identified; however, little is known of the RNAi pathway.
about the regulation of the RNAi pathway itself. Here we describe a Using this system, we screened a collection of 2,000 US Food and chemical biology approach to modulate the RNAi pathway and report Drug Administration–approved compounds and natural products the identification of a small molecule that enhances RNAi and and identified a small molecule named enoxacin that enhanced promotes the biogenesis of miRNA by facilitating the interaction siRNA-mediated mRNA degradation. This small molecule was between trans-activation-responsive region RNA-binding protein enoxacin (Fig. 1a). Enoxacin increased siGFP-mediated gene (TRBP) and RNAs. Our results provide a proof-of-principle demon- knockdown mediated by siRNA against EGFP in our cell-based stration that small molecules can be used to understand what cellular reporter system in a dose-dependent manner, with a median effective factors affect the activity of the RNAi pathway.
concentration (EC50) of B30 mM, whereas it had no effect on the 1Department of Human Genetics, Emory University School of Medicine, 615 Michael St., Atlanta, Georgia 30322, USA. 2Department of Chemistry, The University ofChicago, 929 East 57th St., Chicago, Illinois 60637, USA. 3Department of Molecular and Integrative Neurosciences, The Scripps Research Institute, 5353 Parkside Drive,Jupiter, Florida 33458, USA. 4Department of Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, Texas 75390, USA.
5The College of Chemistry, Peking University, 202 Chengfu Rd., Beijing, 100871, P.R. China. 6These authors contributed equally to this work. Correspondence should beaddressed to P.J. ( Received 8 January; accepted 24 June; published online 20 July 2008; NATURE BIOTECHNOLOGY ADVANCE ONLINE PUBLICATION

293-EGFP RNAi-293-EGFP Enoxacin (50 µM) +Enoxacin (50 µM) Library of 2,000 small molecules Relative quantification of EGFP protein (%) Enhancer of RNAi (enoxacin) Enoxacin (50 µM) Figure 1 Identification of a small molecule enhancing RNAi through a chemical screen. (a) HEK293 cells stably expressing EGFP (293-EGFP) were infected with lentivirus producing shRNA against EGFP (shRNA- EGFP); the resulting RNAi-293-EGFP cells with reduced GFP expression mRNA knockdown (%) were isolated. The RNAi-293-EGFP cells transfected with 2-O-methyl Relative GAPDH mRNA RNA against the GFP siRNA are shown in the middle with the recovery 10–13 10–12 10–11 10–10 10–9 10–8 10–7 of GFP expression. A mutant 2-O-methyl RNA against the GFP siRNA is BACE1 siRNA concentration (M) shown on the right as a negative control. The RNAi-293-EGFP cells were used for a chemical screen, which led to the identification of an RNAi shVector + enoxacin enhancer (enoxacin). The chemical structure of enoxacin is shown shGAPDH + enoxacin on the right. (b) Enoxacin enhances shRNA-EGFP-mediated genesilencing. The GFP protein levels were detected by western blot analysis using anti-EGFP antibody (right), with GAPDH as a loading control. The quantification is shown below. Fluorescence images of RNAi-293-EGFP cells without (top) or with (bottom) enoxacin are shown on the left (exposuretime is different from panel a). Values are mean ± s.d. (c) Enoxacin enhances shGAPDH-mediated gene silencing. Relative GAPDH mRNA levelsin cells are determined by quantitative RT-PCR. Values are mean ± s.d. for triplicate samples. *, P o 0.001. (d) Enoxacin potentiates syntheticsiRNA-induced knockdown of BACE1. Synthetic siRNA against human BACE1 was transfected at a range of concentrations, from 1 pM to 20 nM, inHEK293FT cells. Knockdown of BACE1 mRNA was graphed as a percentage of mock-treated samples in the presence or absence of enoxacin. Values are mean ± s.d. for triplicate samples.
cells expressing GFP only (Fig. 1b and Supplementary Fig. 1).
RNAi-enhancing activity of enoxacin is structure dependent Importantly, enoxacin was relatively nontoxic, even at the high Enoxacin belongs to a family of synthetic antibacterial compounds lishing Gr
concentration of 150 mM, which is lower than a clinical doseSimilar based on a fluoroquinolone skelet. Fluoroquinolones have a broad enhancement of gene knockdown mediated by GAPDH-specific antimicrobial spectrum and are very successful at treating a variety of shRNA (shGAPDH) in cells stably expressing an shGAPDH was also bacterial infection. As a family, fluoroquinolones target bacterial observed upon enoxacin treatment (Fig. 1c). We also tested other type II topoisomerases, such as DNA gyrase in Gram-negative bacteria shRNAs against GFP (different from the GFP used in our reporter and DNA topoisomerase IV in Gram-positive bacter; these agents system), luciferase and Fmr1, and again observed comparable do not inhibit eukaryotic topoisomerase II. Enoxacin has been used to increases (Supplementary Fig. 2), indicating that the effect of enox- treat bacterial infections ranging from gonorrhea to urinary tract 2008 Nature Pub
acin on RNAi is indeed universal.
infectionClinically, side effects have been minimal in adult There are currently two means of harnessing the RNAi machinery To test whether the quinolone family in general acts to enhance the to induce specific suppression of gene expression in cells: shRNAs RNAi pathway, we examined the effects of several other quinolones, and siRNA duplexes. Hence we also questioned whether enox- both commercially available and synthetically modified molecules acin would have any effect on siRNA duplex–induced RNA (enoxacin-V1-3), using our RNAi GFP reporter system (Fig. 3a).
We found that enoxacin consistently gave rise to a left-shift of We found that two of these compounds (ciprofloxacin (Cipro) and the concentration-response curve to an siRNA specifically target- norfloxacin (Noroxin)) have substantial RNAi-enhancing activity; ing human BACE1 mRNA (Fig. 1d). Importantly, the levels of however, these two molecules are less effective than enoxacin itself unrelated transcripts, such as those encoding PINK-1 and actin, (Fig. 3b). Most other commercially available quinolones tested had were not changed, suggesting that enoxacin did not induce either much less or almost no RNAi-enhancing activity. The addition nonspecific effects (data not shown). We also observed similar of sterically blocking groups to the C-3 carboxylate (enoxacin-V1 and enhancement of knockdown efficiency by enoxacin using siRNA enoxacin-V3) and the piperazine terminal nitrogen atom of enoxacin duplexes against different genes in various cell lines (Fig. 2).
(enoxacin-V2) reduced the RNAi-enhancing activity. Substitutions at Furthermore, by comparing the gene knockdown efficiency among the N-1, C-6 and C-7 positions of enoxacin also interfered with its different concentrations of siRNA duplex used for transfection, we RNAi-enhancing activity. The sensitivity of the RNAi-enhancing found that enoxacin substantially reduced the siRNA dosage required activity of enoxacin to chemical substitution suggests that it forms a to achieve comparable knockdown efficiency (Figs. 1d and 2). These specific complex distinct from the known targets of quinolones.
data together suggest that the small-molecule enoxacin enhances RNAi To exclude the possibility that enoxacin enhances RNAi activity by induced by either shRNAs or siRNA duplexes and substan- increasing the expression of one or more components in the RNAi tially reduces the dosage required to achieve gene knockdown in pathway, we first examined the protein levels of multiple components mammalian cells.
in the RNA-induced silencing complex (RISC) and found no ADVANCE ONLINE PUBLICATION NATURE BIOTECHNOLOGY

siRNA against mouse GAPDH b
siRNA against human Htt siRNA against Her2 siRNA against Aha1 siRNA against PP1A Control 10 nM 5 nM siRNA against MAPK1 siRNA against EGFP siRNA against KIF11 siRNA against Actin siRNA against human Figure 2 Enoxacin potentiates additional synthetic siRNA-induced gene knockdown. (a) NIH3T3 cells were transfected with different amounts of siRNAduplexes against mouse GAPDH in the absence or presence of enoxacin. Relative GAPDH mRNA levels in the cells transfected with control and differentdosages of siRNA are determined by quantitative RT-PCR. (b) 293 cells stably expressing Htt were transfected with 10 or 20 nM siRNA duplexes against human Htt in the absence or presence of enoxacin. The amounts of Htt are determined by western blot. (c) MCF-7 cells were transfected with 5 nM siRNAduplexes against human Her2 in the absence or presence of enoxacin. Relative Her2 mRNA levels are determined by TaqMan assay. (d) 293 cells weretransfected with 5 nM siRNA duplexes against human Aha1 in the absence or presence of enoxacin. Relative Aha1 mRNA levels are determined by TaqMan assay. (e) 293 cells were transfected with 5 nM siRNA duplexes against human PP1A in the absence or presence of enoxacin. Relative PP1A mRNA levelsare determined by TaqMan assay. (f) 293 cells were transfected with 5 nM siRNA duplexes against human MAPK1 in the absence or presence of enoxacin.
Relative MAPK1 mRNA levels are determined by TaqMan assay. (g) 293-EGFP cells were transfected with 5 nM siRNA duplexes against EGFP in theabsence or presence of enoxacin. Relative EGFP mRNA levels are determined by quantitative RT-PCR. (h) 293 cells were transfected with 5 nM siRNA duplexes against human KIF11 in the absence or presence of enoxacin. Relative KIF11 mRNA levels are determined by TaqMan assay. (i) HeLa cells weretransfected with 20 nM siRNA duplexes against human actin in the absence or presence of enoxacin. Relative actin mRNA levels are determined by TaqMan assay. (j) 293 cells were transfected with 5 nM siRNA duplexes against human GAPDH in the absence or presence of enoxacin. Relative GAPDH mRNAlevels are determined by TaqMan assay. In panels a and c–j, values are mean ± s.d.
lishing Gr
alteration in these levels in the cells treated with enoxacin (Supple- enoxacin on global gene expressionWe performed microarray mentary Fig. 3). Because previous studies have shown that fluoro- analyses using both HEK293 and mouse NIH3T3 cells. Only a small quinolones could massively increase or reduce steady-state levels of number of genes (36 out of B22,000 genes expressed in HEK293 cells multiple mRNAs at a much higher concentration (250 mM) than we and 10 out of B20,000 genes expressed in NIH3T3 cells) displayed used in this study (50 mM), we further investigated the effect of significant changes (41.6-fold, P o 0.001) in enoxacin-treated 2008 Nature Pub
Oxolinic acid (OA) Relative RNAi-enhancing activity (%) Oxolinic acid (OA) Figure 3 Determination of chemical structure required for RNAi-enhancing activity. (a) The chemical structures of enoxacin variants are shown. (b) RelativeRNAi-enhancing activities of enoxacin variants are shown. RNAi-enhancing activity was determined using RNAi-293-EGFP cells and fluorescencequantification on an Analyst HT plate reader. After subtraction of background fluorescence, the reduction of GFP fluorescence by enoxacin was set as 100%.
Relative fluorescence intensity reductions measured in cells treated with the other compounds were normalized to the fluorescence reduction by enoxacin.
Values are mean ± s.d.
NATURE BIOTECHNOLOGY ADVANCE ONLINE PUBLICATION Figure 4 Enoxacin promotes the processing of miRNAs and the loading of siRNA duplexes onto RISCs. (a) Northern blots show that enoxacin enhances the level of siRNAs and mature miR-125a in cells transfected with shRNA against GFP, luciferase and miR-125a plasmids, respectively. 5S RNA was used as loading control. (b) Quantitative RT-PCR was used to measure the levels of pri-, pre- and mature forms of miR-125a, miR-124a and miR-199b in mock- and enoxacin-treated (50 mM) HEK293 cells. Values are mean ± s.d. for triplicate samples. (c) miRNAs with consistent changes in enoxacin-treated HEK293 cells (transfected HEK293 cells stably expressing pri-miR- 125a were used). Each miRNA was examined by TaqMan MiRNA assay, andmock-treated cells are used as the baseline for all comparisons. The bar graph shows the average fold change with s.d. of the miRNAs that displayed consistent changes in triplicate experiments. (d) Top panel shows the western blot to detect the myc-Ago2 fusion protein in both input and immunoprecipitated complex (IP) using anti-myc antibody. Northern blots detecting the guide strand and passenger strand of siRNA duplexes are shown in the middle. (Note that different probes were used to detect the guide and passenger strands of siRNA duplexes, so the signal intensities appearing on the blot do not reflect the absolute amount of each strand.) The intensity of each band is quantified and indicated under the blot 92 ± 9 100 250 ± 20 100 (untreated Input and untreated IP are 100). Bottom panel shows the relative amount of small RNAs associated with the immunoprecipitated Ago2- 105 ± 8 100 154 ± 12 100 containing RISCs in the presence or absence of enoxacin (75 mM), which was normalized to the inputs. Endogenous miR-30a that was not affected by Relative expression level (%) enoxacin was used as a control (miR-30e shown in panel c is transcribed from a different genomic locus from miR-30a). Values are mean ± s.d.
associated with Ago2 (%) of endogenous miRNAs (142/157) were not significantly affected.
Relative amount of small RNAs Pri+Pre-miR Mature-miR Most of the miRNAs altered by enoxacin (13/15) had approximately twofold increases in expression of the mature form, whereas only two of the miRNAs had decreased levels of the mature forms (Fig. 4c). Aswith miR-125a, we also found decreased levels of the primary and cells, and we were unable to find any gene consistently in both cell precursor forms of the miRNAs whose mature forms increased in the types (Supplementary Tables 1 and 2). These results suggest that presence of enoxacin (Fig. 4b and Supplementary Fig. 5). Interest- lishing Gr
the RNAi-enhancing activity we observed with enoxacin is not ingly, we noted that the precursor forms of the elevated endogenous caused by pleiotropic effects on gene expression. We therefore miRNAs are generally abundant in untreated HEK293 cells, whereas hypothesized that enoxacin must interact specifically with the nucleic the endogenous miRNAs that are not significantly affected by enox- acids and protein(s) involved in the RNAi pathway to increase RNAi- acin generally have very little or undetectable precursor in cells enhancing activity.
(Supplementary Table 3). Furthermore, enoxacin treatment couldincrease the production of mature small RNAs from the miR-30a– Enoxacin promotes processing of miRNAs and loading of siRNAs based shRNAs (pre-miRNA-like RNAs) that were abundant in cells, 2008 Nature Pub
To determine the biological target(s) of enoxacin and the mechanism whereas enoxacin had no effect on endogenous miR-30a, which had by which enoxacin modulates the RNAi pathway, we examined the no detectable steady-state precursor form in cells (Fig. 4a; siLuciferase expression of mature small RNAs in cells stably expressing either and data not shown). These data suggest that enoxacin could promote different shRNAs or the primary transcript of miR-125a (pri-miR- the processing of pre-miRNAs. This enhancement, mediated by 125a). We observed consistent increases in the expression of small enoxacin, depends largely on the amount of precursor RNAs in RNAs in cells treated with enoxacin, despite the use of different cells, rather than specific RNA sequences.
promoters (Fig. 4a and Supplementary Fig. 4). Furthermore, we We also determined the effect of enoxacin on the stability and found that the addition of enoxacin led to increases in the mature loading of siRNA duplexes onto RISC. It has been shown that form of miR-125a and corresponding decreases in the level of pri- Argonaute2 (Ago2) is a key component of the RISC responsible miR-125a alone, as well as decreases in the total level of pri-miR-125a for mRNA cleavage activity (Slicer activity. We isolated Ago2- and precursor miR-125a (pre-miR-125a) (Fig. 4a–b and Supplemen- containing RISCs through immunoprecipitation from HEK293 cells tary Fig. 5). This suggests that enoxacin can promote the processing of transfected with siRNA duplexes and determined the amounts of miR-125a. The shGFP used in our initial reporter system mimics pre- siRNAs associated with Ago2 in the presence or absence of enoxacin miRNAs; therefore, it is processed by Dicer, rather than Drosha, which using quantitative RT-PCR. The addition of enoxacin had no effect on processes pri-miRNAs to pre-miRNAsFurthermore, enoxacin the amount of siRNAs in the input, suggesting that enoxacin does not exerted effects on the siRNA duplex, which likewise does not require simply enhance the stability of siRNAs in vivo (Fig. 4d). With a similar DroshaThese data suggest that enoxacin might function at the level amount of Ago2 protein immunoprecipitated, the amount of trans- of Dicer-mediated precursor processing and/or loading onto RISCs.
fected siRNAs associated with Ago2-containing RISCs increased two- To examine the effect of enoxacin on endogenous miRNAs, we used fold upon treatment with enoxacin, whereas endogenous miR-30a, miRNA TaqMan assays to monitor the profiles of 157 miRNAs in which is not altered by enoxacin, showed no difference (Fig. 4d, top transfected HEK293 cells stably expressing pri-miR-125a. The majority and bottom panels).
ADVANCE ONLINE PUBLICATION NATURE BIOTECHNOLOGY Enoxacin K :94 nM Relative cleavage Relative amount of Percentage of RNAs bound by Control Enoxacin Control Enoxacin Time of binding reactions (minutes) Relative RNAi-enhancing activity Relative GAPDH mRNA level Figure 5 Enoxacin facilitates the TRBP-RNA interaction, and the RNAi-enhancing activity is TRBP-dependent. (a) Left panel shows in vitro processing of Relative GAPDH mRNA radioactively labeled let-7 precursor by either Dicer alone or Dicer with TRBP.
Arrows indicate the precursor and processed miRNAs. Right panel shows the averages of relative cleavage activity from 4 independent experiments (N ¼ 4).
*, P o 0.001 when the reaction with Dicer, TRBP and enoxacin was compared with other reactions. Values are mean ± s.d. (b) RNA-binding assay with recombinant TRBP protein and 5¢-32P-labeled let-7 precursor in the presence or absence of enoxacin (30 mM) is shown in the top panel (RNA-binding time: Relative RNAi-enhancing 60 min). Bottom left panel shows the percentage of let-7 precursor bound by Level of TRBP mRNA: recombinant TRBP over time in the presence or absence of RNAi-E (30 mM).
*, P o 0.001. Bottom right panel shows the percentage of let-7 precursor boundby recombinant TRBP versus log of the protein concentration in the presence orabsence of enoxacin (30 mM). Values are mean ± s.d. (c) The RNAi-enhancing activity is TRBP dependent. The siRNAs against TRBP were transfected intothe cells stably expressing shGAPDH used in Figure 1c in the presence or absence of enoxacin (50 mM). The reduction of TRBP had no effect on shGAPDH- mediated mRNA degradation because the GAPDH mRNA level remained unchanged in the absence of enoxacin. The correlation between TRBP mRNA leveland RNAi-enhancing activity is shown. Values are mean ± s.d.
Because quantitative RT-PCR could not distinguish between guide promotes the processing and loading of siRNAs/miRNAs onto strands bound to Ago2 as a single strand or as part of an siRNA RISCs by facilitating the interaction between TRBP and RNAs in lishing Gr
duplex, we performed northern blot analysis using the same immu- mammalian cells.
noprecipitated RNAs to determine the amounts of both guide-strand To further confirm the role of TRBP in enoxacin-mediated RNAi- and passenger-strand siRNAs associated with Ago2 (Fig. 4d, middle enhancing activity, we performed a series of RNAi experiments using panel). Upon addition of enoxacin, both guide and passenger strands different amounts of siRNA duplexes against TRBP. The siRNAs associated with Ago2 increased. Interestingly, the relative ratio against TRBP were transfected into cells stably expressing an shRNA between guide and passenger strands associated with Ago2 also against GAPDH (Fig. 1c). We determined the RNAi-enhancing increased by 30% in the presence of enoxacin, which suggests that activity of enoxacin in the presence of different levels of TRBP 2008 Nature Pub
enoxacin could promote the loading of siRNA duplexes onto RISCs.
mRNA using the knockdown level of GAPDH as readout. Merely reducing TRBP mRNA to 85% had no effect on shGAPDH-mediated RNAi-enhancing activity is TRBP dependent mRNA degradation (Fig. 5c and Supplementary Table 4); further- Dicer and TRBP play critical roles in the processing and loading of more, the reduction of TRBP mRNA to 50–80% had no effect on miRNAs and siRNAs onto the RI. We next examined whether RNAi-enhancing activity (Fig. 5c and Supplementary Table 4).
enoxacin might be involved in the processing mediated by Dicer and However, when the TRBP mRNA level dropped below 22%, RNAi- TRBP using an established in vitro processing assay. Enoxacin had no enhancing activity was greatly reduced (Fig. 5c and Supplementary effect on the processing of pre-let-7 or pre-miR-30a by Dicer alone.
Table 4). These results together suggest that the RNAi-enhancing However, the addition of enoxacin could enhance the processing of activity of enoxacin is TRBP dependent.
let-7 or pre-miR-30a by Dicer and TRBP together (Fig. 5a andSupplementary Fig. 6). This enhancement was not observed with Enoxacin enhances RNAi in vivo the addition of oxolinic acid, which has much less RNAi-enhancing To determine whether enoxacin has similar effects in vivo, we tested it activity (Fig. 3 and Supplementary Fig. 7a). This result indicated that in a GFP transgenic mouse line. When a lentivirus expressing shGFP enoxacin might target TRBP. Because TRBP binds to miRNA pre- (Lv-siGFP) is injected into these mice early in development, the cursors and facilitates the processing and loading of miRNAs, we construct knocks-down GFP expressionHowever, injections of performed a series of RNA-binding assays to examine the effect of Lv-siGFP into adult mice did not alter GFP protein levels substantially enoxacin on the interaction between TRBP and miRNA precursor. We (data not shown), possibly due to the stability of the GFP protein.
found that the presence of enoxacin increased the binding affinity We therefore chose to monitor the effects of enoxacin through of TRBP for miRNA precursors; the Kd under normal conditions is measurements of GFP mRNA after targeted injections of Lv-siGFP 221 nM, whereas the Kd in the presence of enoxacin is 94 nM (Fig. 5b in young pups. We chose mouse ears for the injections, because they and Supplementary Fig. 7b). These results suggest that enoxacin are easily accessible; we could deliver the virus to a complete ear and NATURE BIOTECHNOLOGY ADVANCE ONLINE PUBLICATION a much higher concentration (250 mM) than we used in this study (50 mM), we examined genome-wide expressioWe observed very few genes with altered expression and found no genes thatdisplayed consistent and substantial changes in the two cell lines tested in our assay. We did, however, find that the processing of those miRNAs whose precursors are abundant at steady state in cells was promoted by enoxacin. Previous studies have shown that overexpres- sion of miRNAs could produce substantial changes in the mRNA Relative GFP mRNA level (%) level. However, in those studies the expression levels of specific miRNAs were elevated substantially, whereas in our assay we saw only a mild approximately twofold increase of mature miRNAs in the cells treated with enoxacin. Furthermore, how this mild increase of specific Lv-siGFP + enoxacin mature miRNAs affects the existing translational suppression remains to be studied in more detail. We have found that the twofold increase Figure 6 Enoxacin enhances RNAi in vivo. The ears of GFP transgenic mice of specific mature miRNA had no effect on the translational suppres- (ACTB-EGFP) were injected with shRNA-EGFP expressing lentivirus or sion of corresponding reporter constructs (Supplementary Fig. 8).
Lv-siGFP, with or without enoxacin treatment (100 mM). The relative GFPmRNA levels in the control ears injected with Lv-siGFP only, injected with Overall, these results indicate that the RNAi-enhancing effect of both Lv-siGFP and enoxacin and injected with enoxacin alone are shown.
enoxacin is specific.
*P o 0.001 when Lv-siGFP is compared with control and Lv-siGFP+enoxacin Using a series of in vitro and in vivo analyses, we found that the is compared with Lv-siGFP alone.
enoxacin-mediated RNAi-enhancing activity is TRBP dependent, andenoxacin could facilitate the interaction between TRBP and RNAs.
obtain enough RNA from a single ear for quantitative RT-PCR Furthermore, we found that enoxacin has no effect in an in vitro analysis. In addition, we could compare the enoxacin-treated and RISC-cleavage assay (Supplementary Fig. 9), which argues against the enoxacin-untreated ears from the same mouse to reduce experimental potential involvement of enoxacin in the step of mRNA-target variation. Three groups of injections were performed: Lv-siGFP alone, recognition and cleavage. Rather, these results together suggest that Lv-siGFP with enoxacin and enoxacin alone. We performed multiple enoxacin targets the step of RISC loading by enhancing the interaction rounds of injections in 10-day-old mice and found that Lv-siGFP between TRBP and RNAs. Indeed, it has been shown that the alone reduced the GFP mRNA level to 80% of control tissues (20% functionality of siRNAs is highly associated with the binding affinity knockdown). The addition of enoxacin enhanced the knockdown of TR; therefore the enhanced interaction between TRBP and efficiency to 60% (40% GFP mRNA level remained), whereas enoxacin RNAs mediated by enoxacin could be the basis of the RNAi-enhancing alone had no effect on GFP expression (Fig. 6), which is consistent activity. Our results indicate that TRBP plays an important role(s) in with our previous cell culture data (Fig. 1b). These results suggest that modulating the activity or efficacy of siRNAs, and enoxacin potentially enoxacin enhances siRNA-mediated mRNA degradation in vivo.
increases RISC loading efficiency and enhances RNAi by targeting lishing Gr
TRBP-RNA interactions. In summary, we have developed a novel cell- based assay to monitor the activity of the RNAi pathway and identified Small noncoding RNAs play important roles in animal development, a small molecule that enhances siRNA-mediated mRNA degradation evolution and human diseaAlthough our understanding of the and promotes the biogenesis of endogenous miRNAs. Our results mechanism of RNAi has dramatically increased with the identification suggest that chemical screens could provide a powerful route to of key proteins involved in the RNAi pathway, the modulation of this understanding the modulation of the RNAi pathway. In addition, an pathway in normal and disease states remains poorly understood, RNAi enhancer could potentially facilitate the development of new 2008 Nature Pub
largely due to the overlapping, redundant and compensatory features RNAi tools and therapeutics.
of the biological pathways regulated by small RNAs Chemical biology approaches that use small molecules to perturb protein networks of biological systems could be used to understand DNA constructs, siRNAs, cell lines and transfections. Lv-siGFP was described how the RNAi pathway is modulated. Using such an approach here, previousThe short hairpin vectors shLuciferase and shGAPDH were we identified a small molecule that enhances RNAi and promotes the obtained from Open Biosystems. Details on other constructs and siRNA biogenesis of miRNA by facilitating the interaction between TRBP and duplexes are described in Supplementary Methods. All cell lines, includingHEK293, HeLa and NIH3T3, were cultured in DMEM with 10% FBS and RNAs. Our results provide a proof-of-principle demonstration that penicillin/streptomycin. Plasmids, 2-O-methyl-oligo siRNA and miRNA duplex small molecules can be used to study the RNAi pathway.
were transfected into cells by Lipofectamine 2000 (Invitrogen). For BACE1 Enoxacin belongs to a family of synthetic antibacterial compounds, siRNAs, the cells were trypsinized and reverse transfected with serial concen- the fluoroquinoloneFluoroquinolones function as bacterial type II trations of BACE1 siRNA (20 nM, 10 nM, 1 nM, 100 pM, 10 pM and 1 pM) topoisomerase inhibitors. To determine the specificity of enoxacin as using 0.2% Lipofectamine 2000 and the standard protocol. For siTRBP an enhancer of RNAi, we also examined additional members of the experiments, different concentrations of siTRBP (10 nM, 20 nM, 50 nM, fluoroquinolone family; only a select few of these compounds 100 nM and 200 nM) were used. Stable cell lines were generated through had substantial RNAi-enhancing activity, suggesting that the RNAi- selection using appropriate antibiotics. All the transfection experiments were enhancing activity does not depend on general fluoroquinolone repeated at least three times. For most of the experiments performed in this activity, but rather on the unique chemical structure of enoxacin study, the final concentration of enoxacin is 50 mM. Enoxacin was incubatedwith cells for 48 h before biological assays.
and a few related family members.
To further exclude the possibility that the RNAi-enhancing effect we Small-molecule screen, microscopy and fluorescent plate reading. Based on observed is due to pleiotropic effects of enoxacin as a member of the the levels of GFP fluorescence intensity, individual clones of 293-EGFP-siGFP fluoroquinolone family, which is known to alter gene expression at were isolated. Several clones were used for the chemical screen. Cells were ADVANCE ONLINE PUBLICATION NATURE BIOTECHNOLOGY plated into 24-well plates. We added 2,000 individual drugs from The Spectrum lysate proteins were separated by SDS-PAGE and probed with anti-Myc Collection (10 mM in DMSO, MicroSource Discovery Systems) into individual mAb to detect levels of Myc-tagged Ago2.
wells at a final concentration of 50 mM in 24 h. GFP fluorescence of each well Purification of recombinant TRBP. His was then visually inspected in 48 h using an inverted fluorescence microscope.
6-tagged TRBP was expressed in Escherichia coli BL21 (DE3) cells and purified with the Ni-NTA Fast Start Kit Compounds that obviously changed EGFP fluorescence were chosen for follow- (Qiagen). The purity of the protein was analyzed by SDS-PAGE and its size was up study. Images were taken using LSM 510 confocal microscope (Zeiss). To compared with a His-tagged standard (Invitrogen). Protein concentration was quantify RNAi-enhancing activity, we measured EGFP fluorescence intensity in determined by Bradford Reagent Assay (Invitrogen).
48 h on an Analyst HT plate reader (Molecular Devices). An excitation filter at485 nm and an emission filter at 520 nm were used with a dichroic mirror of In vitro miRNA precursor processing assay and TRBP binding assay. Let-7 505 nm. To calculate an EC50, the maximum effect of RNAi enhancement was precursor RNA oligos were described previously and synthesized by Dhar- defined as the enoxacin effect at 100 mM.
macon (ref. 30). Human miR-30a precursor (GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUGUUU Chemical synthesis. Enoxacin and other fluoroquinolones tested here were GCAGCUGC) was synthesized by Dharmacon, as well. They were radioactively purchased from Sigma. Enoxacin-V1, V2 and V3 were chemically synthesized labeled at the 5¢ end with 32P-g-ATP using T4 polynucleotide kinase (New as detailed in Supplementary Methods.
England Biolabs). The labeled precursor was allowed to refold by heating at95 1C for 2 min, followed by incubation at 37 1C for 1 h. For the processing Quantitative RT-PCRs, microarrays and western blot analyses. Real-time assay, the labeled precursor was incubated with either Dicer or Dicer with PCR was performed with gene-specific primers and Power SYBR Green PCR TRBP in the buffer as described previously for 1 The reaction was Master Mix (Applied Biosystems) using a 7500 Fast Real-Time PCR system terminated and subjected to phenol/chloroform extraction and ethanol pre- (Applied Biosystems). Profiling of mature miRNA expression was performed cipitation. Then the samples were separated on a 15% TBE urea gel, transferred using Applied Biosystems' TaqMan miRNA assays with 8-plex reverse tran- and UV crosslinked to nylon membrane, which was then exposed for scription and individual TaqMan miRNA real-time PCR assays according to PhosphorImager scanning. Both unprocessed and processed precursors were protocols provided by the vendor. Gene expression profiles were evaluated quantified using Kodak MI software. The percentage of processed RNAs was using Affymetrix Expression Arrays, HG-U133_Plus_2 and Mouse430_2. For used to calculate relative cleavage activity, with no enoxacin as a control western blotting, protein samples were separated on SDS-PAGE gels and then (100%). Four independent experiments were performed and used to calculate transferred to PVDF membranes (Millipore). Membranes were processed mean and s.d.
following the ECL western blotting protocol (Amersham). The details of these TRBP and let-7 precursor binding reactions were carried out in 1
binding experiments are described in Supplementary Methods.
buffer (20 mM Tris-HCl, pH 8.0, 15 mM NaCl, 2.5 mM MgCl2) with 150 ng ofpurified recombinant TRBP and 10 ng 32P-labeled let-7 precursor in a total Northern blot of small RNAs. RNAs were isolated with TRIzol (Invitrogen), volume of 30 ml with or without 30 mM RNAi-E (or RNAi-E V5) at 30 1C for and then separated on 15% TBE urea gel, transferred and UV crosslinked 5, 10, 30, 60, 90, 120 and 180 min. The reaction mixtures were then brought to nylon membrane (Osmonics). 32P-UTP–labeled probes were prepared into contact with a UV lamp in a CL-1000 Ultraviolet Crosslinker (Stratagene) with the Ambion mirVana miRNA Probe Construction Kit. Membranes for 5 min on ice. After crosslinking, the samples were mixed with an equal were prehybridized at 65 1C for 1 h and hybridized for 12–16 h at 25 1C.
volume of 2
Gel Loading Buffer (Applied Biosystems) and incubated for Membranes were then washed three times at 25 1C and two times at 42 1C.
5 min at 95 1C. The denatured samples were separated onto 10% SDS-PAGE Membranes were exposed and scanned with a Typhoon 9200 PhosphorImager followed by gel dry using Gel Dryer (Fisher). The dried gels were exposed to lishing Gr
Storage Phosphor Screen (Amersham Pharmacia Biotech) and the screenswere scanned using a Typhoon 9200 PhosphorImager then quantified using Determination of small RNA duplex loaded onto RISCs. To quantify the Kodak MI software. The percentage of RNAs bound by TRBP was used to transfected small RNA duplex loaded onto RISCs, we used the expression calculate the binding activity. At least four independent experiments were vector of Myc-Ago2 fusion protein and synthesized small RNA duplex. For ease performed and used to calculate mean and s.d. For nitrocellulose filter binding of quantification, we used duplexes that resemble human miR-125a. In an assay, TRBP and let-7 precursor binding reactions were carried out in earlier study we found that the expression of miR-125a in HEK293 cells is 1
binding buffer (20 mM Tris-HCl, pH 8.0, 15 mM NaCl, 2.5 mM MgCl2) extremely low and could not be detected using either the MiRNA TaqMan assay 2008 Nature Pub
with different amounts of purified recombinant TRBP and 10 ng 32P-labeled or northern blot. Briefly, HEK293FT (‘fast transfect') cells were either let-7 precursor in a total volume of 30 ml with or without 30 mM enoxacin at transfected with Myc-tagged Ago2 plasmid or cotransfected with both Myc- 30 1C for 60 min. Binding solutions were passed through MF-membrane filters tagged Ago2 expression vector and miR-125a duplexes (100 mM) using (0.45 HA, Millipore) and washed with 4 ml of ice-cold wash buffer containing Lipofectamine 2000. The transfected cells were split 24 h after transfection 50 mM Tris and 20 mM KCl (pH7.4). After the wash buffer was drained, and treated with either no enoxacin or 75-mM enoxacin for 48 h before the membranes were dried for 2 min at 25 1C. The dried membranes were collecting the cells for immunoprecipitation. The collected cells were lysed in immersed into ScintiVerse BD Cocktail (FLUKA), and liquid scintillation lysis buffer containing 20 mM HEPES, pH 7.4, 10 mM NaCl, 1 mM MgCl2, was counted using a LS6500 Multipurpose Scintillation Counter (Beckman).
0.2 mM EDTA, 0.35% Triton-X100 (ref. 29) and 2
protease inhibitor cocktail Data were plotted as relative amount of total RNA bound versus log of the tablet (Roche) for 10 min. Ten percent of lysates were saved in 1 ml TRIzol for TRBP concentration, and Kd was determined with KaleidaGraph software total RNA isolation as inputs. The remaining lysates were centrifuged at 20,000g (Synergy Software).
for 20 min at 4 1C. Protein concentrations of the supernatants were quantifiedusing Bradford Reagent (Bio-Rad). Lysates were adjusted to the concentrations Mice and lentiviral injection. All animal procedures were performed based on of 1 mg/ml, and 500 mg total proteins were used for immunoprecipitation protocols approved by Emory University Institutional Animal Care and Use overnight at 4 1C using anti-Myc mAb (Invitrogen) together with Protein A Committee. The GFP transgenic line C57BL/6-Tg(ACTB-EGFP)1Osb/J was Agarose Beads (Invitrogen). Immunoprecipitation beads were washed with the obtained from The Jackson Laboratory. The lentivirus Lv-siGFP was produced lysis buffer five times; 10% of the washed immunoprecipitation beads were as described previouslyIndividual GFP transgenic mice (10 d old) were used for western blots, and the remaining 90% for RNA extractions.
injected with the lentivirus Lv-siGFP (2 ml) into either one ear (to demonstrate the effect of Lv-siGFP only) or both ears (for injection of enoxacin or control with the High-Capacity cDNA Archive Kit (Applied Biosystems) combined later) (day 10). Enoxacin or control solution (mock) (2 ml) was then injected with hsa-miR-125a– and has-mir30a-3p–specific primers (Applied Biosystems).
once a day for 3 consecutive days (days 12, 13 and 14) into one of the ears 2 d after Lv-siGFP injection. The concentration of injected enoxacin solution was specific for has-miR-30a-3p and has-miR-125a. Proteins extracted from 100 mM. As a negative control, a group of mice were also injected with enoxacin the 10% immunoprecipitation beads and an equal amount of input or control solution into one ear. Mice were then killed (day 15), and the NATURE BIOTECHNOLOGY ADVANCE ONLINE PUBLICATION ears were removed and used for RNA isolation and quantitative RT-PCR 6. Dykxhoorn, D.M. & Lieberman, J. Running interference: prospects and obstacles to analysis of GFP mRNA. For each condition, at least six mice in three different using small interfering RNAs as small molecule drugs. Annu. Rev. Biomed. Eng. 8,377–402 (2006).
groups were injected.
7. Tiscornia, G., Singer, O., Ikawa, M. & Verma, I.M. A general method for gene knockdown in mice by using lentiviral vectors expressing small interfering RNA. Proc. Natl. Acad.
Statistical methods. We used single-factor ANOVA analysis to show significant Sci. USA 100, 1844–1848 (2003).
differences between control and enoxacin treatment. We performed post-hoc 8. Hutvagner, G., Simard, M.J., Mello, C.C. & Zamore, P.D. Sequence-specific inhibition of t-tests (two-sample assuming equal variances) to determine significance and small RNA function. PLoS Biol. 2, E98 (2004).
indicated P value.
9. Patel, S.S. & Spencer, C.M. Enoxacin: a reappraisal of its clinical efficacy in the treatment of genitourinary tract infections. Drugs 51, 137–160 (1996).
10. Pasquinelli, A.E. Demystifying small RNA pathways. Dev. Cell 10, 419–424 (2006).
Note: Supplementary information is available on the website.
11. Bhanot, S.K., Singh, M. & Chatterjee, N.R. The chemical and biological aspects of fluoroquinolones: reality and dreams. Curr. Pharm. Des. 7, 311–335 (2001).
12. Hopper, D.C. & Wolfson, J.S. Quinolone Antimicrobial Agents 3rd edn. (ASM Press, We would like to thank S. Warren, S. Chang, K. Garber and C. Strauss for Washington, DC; 2003).
their helpful discussions and critical reading of the manuscript and H. Ju for 13. Mitscher, L.A. Bacterial topoisomerase inhibitors: quinolone and pyridone antibacterial technical assistance. We thank I. Verma, J. Belasco and G. Hannon for providing agents. Chem. Rev. 105, 559–592 (2005).
us the plasmids. Q.L. is a Damon Runyon Scholar (DRS-43) and is supported 14. Schaeffer, A.J. The expanding role of fluoroquinolones. Am. J. Med. 113 Suppl 1A, 45S–54S (2002).
by the Welch Foundation (I-1608). P.J. is supported by NIH grants (NS051630 15. Dalhoff, A. & Shalit, I. Immunomodulatory effects of quinolones. Lancet Infect. Dis. 3, and MH076090). P.J. is the recipient of a Beckman Young Investigator Award 359–371 (2003).
and a Basil O'Connor Scholar Research Award and is an Alfred P. Sloan 16. Eriksson, E., Forsgren, A. & Riesbeck, K. Several gene programs are induced in Research Fellow in Neuroscience.
ciprofloxacin-treated human lymphocytes as revealed by microarray analysis. J. Leukoc.
Biol. 74, 456–463 (2003).
AUTHOR CONTRIBUTIONS 17. Rand, T.A., Ginalski, K., Grishin, N.V. & Wang, X. Biochemical identification of P.J. designed the research. G.S. conducted the chemical screen and identified the Argonaute 2 as the sole protein required for RNA-induced silencing complex activity.
Proc. Natl. Acad. Sci. USA 101, 14385–14389 (2004).
small molecule presented in this paper. G.S. and Y.L. performed the majority of 18. Liu, J. et al. Argonaute2 is the catalytic engine of mammalian RNAi. Science 305, mechanistic experiments. J.Z., L.L., Z.S. and C.H. performed chemical synthesis.
1437–1441 (2004).
G.S., Y.L., W.L., M.A.F., A.M.K. and C.W. performed additional testing on the 19. Bernstein, E., Caudy, A.A., Hammond, S.M. & Hannon, G.J. Role for a bidentate compound. K.E.S. and R.D. performed miRNA profiling and developed the ribonuclease in the initiation step of RNA interference. Nature 409, 363–366 (2001).
reporter system. A.W.S.C., Z.P. and Q.L. provided some reagents used in this 20. Chendrimada, T.P. et al. TRBP recruits the Dicer complex to Ago2 for microRNA paper. G.S., Y.L. and P.J. wrote the paper.
processing and gene silencing. Nature 436, 740–744 (2005).
21. Jiang, F. et al. Dicer-1 and R3D1-L catalyze microRNA maturation in Drosophila. Genes COMPETING INTERESTS STATEMENT Dev. 19, 1674–1679 (2005).
22. Forstemann, K. et al. Normal microRNA maturation and germ-line stem cell main- The authors declare competing financial interests: details accompany the full-text tenance requires Loquacious, a double-stranded RNA-binding domain protein. PLoS HTML version of the paper at Biol. 3, e236 (2005).
23. Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T. & Nishimune, Y. ‘Green mice' as a Published online at source of ubiquitous green cells. FEBS Lett. 407, 313–319 (1997).
Reprints and permissions information is available online at 24. Jackson, A.L. et al. Widespread siRNA ‘‘off-target'' transcript silencing mediated by seed region sequence complementarity. RNA 12, 1179–1187 (2006).
25. Lim, L.P. et al. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433, 769–773 (2005).
26. Jing, Q. et al. Involvement of microRNA in AU-rich element-mediated mRNA instabil- 1. Hannon, G.J. RNA interference. Nature 418, 244–251 (2002).
ity. Cell 120, 623–634 (2005).
lishing Gr
2. Bartel, D.P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 27. Katoh, T. & Suzuki, T. Specific residues at every third position of siRNA shape its 281–297 (2004).
efficient RNAi activity. Nucleic Acids Res. 35, e27 (2007).
3. Plasterk, R.H. Micro RNAs in animal development. Cell 124, 877–881 (2006).
28. Duan, R., Pak, C. & Jin, P. Single nucleotide polymorphism associated with mature miR- 4. Zamore, P.D. & Haley, B. Ribo-gnome: the big world of small RNAs. Science 309, 125a alters the processing of pri-miRNA. Hum. Mol. Genet. 16, 1124–1131 (2007).
1519–1524 (2005).
29. Chu, C.Y. & Rana, T.M. Translation repression in human cells by microRNA-induced 5. Dykxhoorn, D.M. & Lieberman, J. The silent revolution: RNA interference as gene silencing requires RCK/p54. PLoS Biol. 4, e210 (2006).
basic biology, research tool, and therapeutic. Annu. Rev. Med. 56, 401–423 30. Hutvagner, G. & Zamore, P.D. A microRNA in a multiple-turnover RNAi enzyme complex. Science 297, 2056–2060 (2002).
2008 Nature Pub

ADVANCE ONLINE PUBLICATION NATURE BIOTECHNOLOGY

Source: http://www.effigene.com/news/pdf/naturbiotech_2008.pdf