HM Medical Clinic

 

Insertion of two animo acids combined with changes in reverse transcriptase containing tyrosine-215 of hiv-1 resistant to multiple nucleoside analogs

Insertion of two animo acids combined with changes
in reverse transcriptase containing tyrosine-215 of
HIV-1 resistant to multiple nucleoside analogs
J. Jacques de Jong, Jaap Goudsmit, Vladimir V. Lukashov,
rank de Wolf
and Suzanne Jurriaans
Objective: To identify genotypic drug resistance patterns of HIV-1 in patients who
were extensively pretreated with anti-HIV drugs and not responding to their current
antiretroviral combination therapy.
Methods: Drug susceptibility of the viruses was tested by a phenotypic recombinant
virus assay. Genotypic analysis of HIV resistance was performed by sequencing of
the amino-terminal part of the corresponding reverse transcriptase (RT) gene (amino
acids 1–280) for serum-derived and recombinant viruses.
Results: Among viruses from 92 patients studied, three (3%) viruses contained a
T
Y amino-acid change as well as a previously unseen combination of an amino- acid change at codon 67 (N→E/S) and a two amino-acid insertion between codons68 and 69 of the RT gene of HIV-1. Phenotypic resistance analysis showed highlevels of resistance to zidovudine, lamivudine and stavudine (in all patients) andmoderate levels of resistance to didanosine and zalcitabine (in two patients),whereas neither serum-derived nor recombinant viruses contained previously knownamino-acid changes conferring resistance to didanosine, zalcitabine, lamivudine andstavudine. However, all recombinant viruses contained an insertion of two aminoacids between codons 68 and 69 of RT as well as an amino-acid change at codon67, as was seen in the serum-derived viruses.
Conclusions: Antiretroviral therapy including zidovudine may yield replicating
viruses with a two amino-acid insertion in RT in combination with amino-acid
changes at codons 67 and 215, which are highly resistant to lamivudine and
stavudine on top of zidovudine and have unpredictable susceptibility to didanosine
and zalcitabine despite lack of previously reported corresponding resistance-
associated amino-acid changes. It is currently unknown what regimens can induce
the emergence of this type of multidrug-resistant viruses. This will only be elucidated
when resistance assays are capable of detecting these mutants.
1999 Lippincott Williams & Wilkins AIDS 1999, 13:75–80
Keywords: Antiretroviral therapy, zidovudine, multidrug resistance,
nucleoside reverse transcriptase inhibitors,
From the Department of Human Retrovirology, Academic Medical Centre, University of Amsterdam, the *Onze Lieve VrouweGasthuis, Location Prinsengracht, and the †Department of Internal Medicine, Academic Medical Centre, University ofAmsterdam, Amsterdam, The Netherlands.
Requests for reprints to: Jaap Goudsmit, Department of Human Retrovirology, Academic Medical Centre, University ofAmsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands.
Date of receipt: 23 June 1998; revised: 6 October 1998; accepted: 14 October 1998.
Lippincott Williams & Wilkins
AIDS 1999, Vol 13 No 1
The three patients presented in this study were visitingthe Onze Lieve Vrouwe Gasthuis, Location Development of drug-resistant mutants is a general Prinsengracht (patients 1 and 3) or the Academic problem in antiretroviral treatment of HIV-1-infected Medical Centre, University of Amsterdam (patient 2) for clinical and virological follow-up. Patient 1 was a bility to particular drugs of drug-resistant mutants in 28-year-old homosexual man known to be HIV-1- individual patients is highly variable and depends on positive since June 1995, patient 2 was a 26-year-old the type and effectiveness of treatment regimens.
homosexual man known to be HIV-1-positive since Assessment of anti-HIV-1 drug resistance before the April 1991, and patient 3 was a 48-year-old homosex- start and during treatment is therefore advised to assure ual man known to be HIV-1-positive since October long-term efficacy of therapy or to change to appropri- 1985. The history of the treatment regimens for the assessment of anti-HIV-1 drug resistance, various phe- Disease Control and Prevention classes and serum developed. Genotypic assays are based on detection of three patients HIV-1 RNA levels had decreased during mutations within the pol gene of HIV-1 that have been associated with drug resistance. For first-line therefore their viruses were tested for drug-resistant assessment, however, the phenotypic characterization amino-acid changes. of susceptibility of HIV-1 to antiretroviral drugs is themethod of choice for the determination of resistance- Quantification of HIV-1 RNA
associated mutations in the pol gene, because our HIV-1 viral RNA levels were determined in EDTA- knowledge of the relationship between virus drug sus- treated plasma using the NucliSens assay (Organon ceptibility and complex genotypic mutational patterns Teknika, Boxtel, The Netherlands), which has a detec- that are often observed in patients under combination tion limit of 400 copies/ml with an input of 200 µl therapy is still insufficient.
Phenotypic recombinant virus assay
Introduction of new antiretroviral drugs and drug com-binations extends the spectrum of mutations in the Drug susceptibility of the viruses infecting the patients HIV-1 pol gene that are associated with drug resistance.
was tested using a phenotypic recombinant virus assay This requires genotypic assays to be regularly updated.
So far, all commercially available genotypic assays for RNA was extracted from serum, and a 2.2 kb fragment HIV-1 drug resistance are based on detection of the containing the entire HIV-1 protease and RT-coding nucleotide substitutions (amino-acid changes) shown to sequence was amplified by nested reverse transcription be related to a particular drug-resistant phenotype. In PCR (RT-PCR). The pool of protease–RT-coding the present study, we identified three patients failing sequences was then cotransfected into CD4+ T lym- long-term antiretroviral therapy whose viruses acquired phocytes (MT4) with the pGEMT3∆PRT plasmid an unusual combination of amino-acid changes and an from which most of the protease (codons 10–99) and insertion of two amino acids between codons 68 and RT (codons 1–482) sequences had been deleted. Dueto homologous recombination, chimeric viruses con- 69 and were resistant to lamivudine (3TC), stavudine taining protease and RT-coding sequences derived (D4T), didanosine (ddI), and zalcitabine (ddC) despite from HIV-1 RNA in serum were generated. Using an lack of previously reported corresponding resistance- associated amino-acid changes. We report the geno- trazolium bromide-based cell viability assay, the suscep- typic and phenotypic characterization of these viruses.
tibility [50% effective concentration (EC )] of the chimeric viruses to the protease inhibitors indinavir,nelfinavir, ritonavir and saquinavir, and the RTinhibitors zidovudine (ZDV), 3TC, ddI, ddC, D4T, Materials and methods
and nevirapine (NVP) were determined. According tothe manual, a ratio (EC recombinant patient reference IIIB virus) above 4 for a certain By 1 January 1998, genotypic analysis of HIV resistance drug was the criteria of resistance to that drug.
by sequencing the amino-terminal part of the RT gene(amino acids 1–280) had been performed for viruses Sequencing serum-derived virus
from 228 patients, most of whom had failed antiretro- Viral RNA was isolated from 200 µl serum using viral therapy. In 144 of the patients, genotypic changes guanidine thiocyanate method, as described elsewhere associated with drug resistance against RT inhibitors were found; in 92 (64%) patients, the T 42°C for 50 min by using the antisense primer 3′-half acid change was found, which was combined with the W amino-acid change in 60 (42%) patients.
GTCA, HxB2 positions 3535–3505). RT reactions Drug-resistant insertion in RT de Jong et al.
Fig. 1. Anti-HIV-1 drug history of the patients studied. The dates when the viruses were recovered from the patients are
shown as the last dates on the time axes.
consisted of 100 ng primer, 250 µmol/l of each dNTP, for 5 min, 40 cycles of 95°C for 1 min, 55°C for 1 min 10 mmol/l Tris-HCl (pH 8.3), 50 mmol/l KCl, 0.1% and 72°C for 2 min, and then 72°C for 10 min. Triton, 2.4 mmol/l MgCl , 100 U Superscript II RT (Life Technologies), and 20 U RNAsin in a final vol- To obtain enough material for sequencing, we subse- ume of 25 µl. Subsequently, a fragment of 1460 base quently performed two different nested PCR, resulting pairs encompassing the protease gene and codons in fragments designated fragment B or C. For both 1–318 of RT was amplified by using the sense primer nested PCR, 5 µl of the first PCR was amplified for 5′-PROT-FM (5′-CAAGGGAAGG CCAGGGAA 25 cycles in a total reaction volume of 50 µl. The TTT, HxB2 positions 2111–2130) and the antisense following primers were used for the generation of the primer 3′-half RT. The PCR reaction mixture (final two fragments: SP6-5′-P66-OUT (5′-GATTTAGG volume 75 µl) was added to the cDNA reaction mix- ture containing 100 ng of the sense primer 5′-PROT- AAT, HxB2 positions 2521–2541) and 3 ′-END FM, 183 µmol/l of each dNTP, 20 mmol/l Tris-HCl (pH 8.3), 50 mmol/l KCl, 0.1 mg/ml bovine serum AATATTGCTGGTGATCCTTTCCA, HxB2 posi- albumin, 2.4 mmol/l MgCl , 2 U Taq polymerase tions 3065–3041) for fragment B, and 5′-SP6-C-SEQ (Perkin-Elmer Cetus). The cycle conditions were 95°C Table 1. Patient characteristics.
HIV RNA (copies/ml) At start of latest CDC, Centers for Disease Control and Prevention.
AIDS 1999, Vol 13 No 1
CATTTACCATACC, HxB2 positions 2962–2982) In addition to the amino-acid changes described above, and 3′-half POL-T7 (5′ TAATACGACTCACTA serum-derived viruses from all three patients showed the insertion of two amino acids (SS in two patients, HxB2 positions 3498–3477) for fragment C. The SV in one patient) between amino-acid positions nested PCR reaction mixture contained 50 ng of the primers described above, 200 µmol/l of each dNTP, 5 two-amino-acid insertions differed from each other on µl of 10 × Gold PCR buffer II, 1.6 mmol/l MgCl , 1.25 U AmpliTaq Gold (Perkin-Elmer Cetus). The ously described amino-acid changes at codon 67 (D E cycle conditions were 95°C for 10 min, 25 cycles of in two patients, D S in one patient) were observed.
95°C for 1 min, 55°C for 1 min and 72°C for 2 min, Sequence patterns that were common for the three and then 72°C for 10 min. The PCR fragments were directly sequenced from the non-coding strand. Thenested primers were extended with an SP6 primer Phenotypic resistance analysis
sequence (5′-GATTTAGGTGACACTATAGG for Patient 1 had a serum HIV-1 RNA load of 320 000 the sense primer and with a T7 sequence (5′-TAAT copies/ml after receiving ddI, D4T and indinavir for ACGACTCACTATAGGG) for the antisense primers to enable population sequencing with fluorescence- analysis revealed high (> 10-fold) resistance (EC50 labelled SP6 and T7 primers (Taq dye primers, Applied recombinant patient virus/EC reference IIIB virus) to Biosystems, Foster City, California, USA; Thermo ZDV, 3TC, ddC and D4T, intermediate (4–10-fold) Sequenase fluorescence-labelled primer cycle-sequencing kit, Amersham, Little Chalfont, Buckinghamshire, For patient 2, treatment with 3TC, D4T and SQV UK). The sequence products were analysed on an lasted 1 month, at which point the serum HIV-1 RNA automatic sequencer (Applied Biosystems DNA sequencer model 370A and 373A stretch, Foster City, Phenotypic resistance analysis showed high resistance to California, USA).
ZDV, 3TC, ddI, D4T, intermediate resistance to ddC,resistance analysis was performed 4 months after he hadstopped his last regimen (consisting of ddI, D4T, NVP,RTV and SQV) while having a viral load of 87 000 Genotypic resistance analysis
showed high fold-resistance to ZDV, 3TC, D4T and A combination of the SS/V insertion with the confirm whether genotypes of recombinant viruses D E/S amino-acid change was found in three (3%) out were identical to serum-derived viruses, we sequenced of 92 patients with the T Y amino-acid change, or in a fragment of the RT gene (amino acids 1–280) of the three (2%) out of 144 patients who had any amino-acid recombinant viruses. For all patients, identical amino- change associated with drug resistance against RT acid sequences of their serum-derived and recombinant inhibitors. The serum-derived virus of patient 1 viruses were observed.
showed the ZDV resistance-associated amino-acidchanges M L, L 2, the virus had the ZDV resistance-associated amino-acid change T Y. Sequencing the virus obtained from patient 3 revealed the NVP resistance-associated amino-acid changes A G and Y resistance-associated changes L In this study, we found viruses with the insertion of the A V change associated with resistance to multiple two amino acids between positions 68 and 69 (SS or SV, SS/V ) and the amino-acid change at codon 67 Table 2. Susceptibility to anti-HIV reverse transcriptase drugs and resistance-associated mutations.
EC , 50% effective concentration ratio.
Drug-resistant insertion in RT de Jong et al.
Table 3. Sequence of HIV-1 reverse transcriptase between residues 65 and 70 in combination with resistance-associated mutations.
69 70 74 75 77 98 100 103 106 108 116 151 181 184 188 190 210 215 219 Sequence patterns that are common between the three patients are shown in bold type. ZDV, Zidovudine; ddI, didanosine; ddC, zalcitabine. (D E or D S) in three patients who were extensively to the resistance profile observed. Due to the complex- pretreated with anti-HIV drugs and were not respond- ity and individual difference in genotypic changes in ing to their current antiretroviral combination therapy.
the three patients, a complete analysis of cooperation Earlier, a virus with a three amino-acid insertion at the between the insertion and particular amino-acid same position had been recovered from a single patient changes at other position requires much more time. At present, it is not possible to assess the precise rate of receiving ddI and hydroxyurea had a similar insertion appearance of the insertion mutants in patients; appar- in RT, which was located between amino acids 69 and ently, this is highly variable for different groups of 70 instead of between amino acids 68 and 69. This patients and depends on type and effectiveness of treat- difference could be due to peculiarities of sequence ment. We found a combination of the SS/V alignments or could indicate that there is some flexibility tion with the D E/S amino-acid change in three (3%) in the location of the insertion in RT.
out of 92 patients with the T Y amino-acid change, or in three (2%) out of 144 patients with any amino- Phenotypic resistance measurements revealed a high acid change associated with drug resistance against RT inhibitors. Our study, together with previous reports, three patients. However, sequence analysis of the indicates that the SS/V insertion is not an unusual serum-derived viruses and recombinant viruses of these phenomenon during antiretroviral therapy and should patients did not show the 3TC resistance-associated therefore be considered in genotypic analysis of anti- V and D4T resistance-associated I T and V T retroviral resistance in patients.
amino-acid changes. Moreover, in patients 1 and 2,reduced susceptibility for ddI (6- and 16-fold, respec- In summary, our study demonstrates the emergence of tively) and ddC (17- and 6-fold, respectively) was HIV-1 strains with an insertion of two amino acids detected by the phenotypic assay without detection of between positions 68 and 69 and a D E/S amino-acid the K R, T D, or L V amino-acid changes.
change. These viruses are resistant to ZDV, 3TC andD4T (and, in two patients, to ddI and ddC) in the Recently, it has been demonstrated that in the absence absence of previously known amino-acid changes asso- of other drug-resistant amino-acid changes, the T SSA ciated with resistance to ddI, ddC, 3TC and D4T. The insertion alone reduces virus susceptibility to ZDV and significance of this finding can only be assessed when drug-resistance assays are able to detect these genotypic (found in patient 3) has been shown to reduce ZDV susceptibility by sixfold in combination with T SSA, without additional impact on susceptibility to D4Tthree patients had a D E or D S amino-acid change.
The D N change is associated with ZDV resistance, but according to our sequence database and that of Los not been previously described. The D E or D S The authors thank Margreet Bakker, Joke Brouwer, changes and perhaps other amino-acid changes Esther van Egmond, Claudie Breuer, Marieke van observed in the three patients may thus play a role in Putten and Elles Voermans for viral load determination, the insertion of two amino acids in RT and contribute and Lucy D. Phillips for editorial review.
AIDS 1999, Vol 13 No 1
10. De Wolf F, Hogervorst E, Goudsmit J, et al.: Syncytium-inducing
and non-syncytium-inducing capacity of human immuno-
deficiency virus type 1 subtypes other than B: phenotypic and
1. Hirsch MS, Conway B, D'Aquila RT, et al.: Antiretroviral drug
genotypic characteristics. AIDS Res Hum Retroviruses 1994,
resistance testing in adults with HIV infection: implications
for clinical management. International AIDS Society–USA
11. Lukashov VV, Kuiken CL, Goudsmit J: Intrahost human
Panel. JAMA 1998, 279:1984–1991.
immunodeficiency virus type 1 evolution is related to length
Current knowledge of HIV-1 reverse transcriptase
of the immunocompetent period. J Virol 1995, 69:6911–6916.
mutations selected during nucleoside analogue therapy: the
12. Iversen AK, Shafer RW, Wehrly K, et al.: Multidrug-resistant
potential to use resistance data to guide clinical decisions.
human immunodeficiency virus type 1 strains resulting from
J Antimicrob Chemother 1997, 40:765–777.
combination antiretroviral therapy. J Virol 1996,
3. Brown AJ, Richman DD: HIV-1: gambling on the evolution of
drug resistance? Nat Med 1997, 3:268–271.
13. Shirasaka T, Kavlick MF, Ueno T, et al.: Emergence of human
4. De Wolf F, De Jong JJ, Hertogs K, Danner SA, Lange JM, immunodeficiency virus type 1 variants with resistance to
Goudsmit J: Virological evaluation of treating HIV-infected
multiple dideoxynucleosides in patients receiving therapy
patients with (combinations of) antiretroviral drugs at the
with dideoxynucleosides. Proc Natl Acad Sci U S A 1995,
Amsterdam Academic Medical Center, 1996/1997. Ned
Tijdschr Geneeskd 1998, 142:573–578.
14. Ross L, Johnson M, Graham N, Shaefer M, Griswold M, St Clair 5. Hertogs K, De Bethune MP, Miller V, et al.: A rapid method for
M: An in frame insertion into the HIV RT gene is associated
simultaneous detection of phenotypic resistance to inhibitors
with a decreased patient viral load. Fifth Conference on
of protease and reverse transcriptase in recombinant human
Retroviruses and Opportunistic Infections. February 1998, immunodeficiency virus type 1 isolates from patients treated
Chicago [abstract 679].
with antiretroviral drugs. Antimicrob Agents Chemother 1998,
15. De Antoni A, Foli A, Lisziewicz J, Lori F: Mutations in the pol
gene of human immunodeficiency virus type 1 in infected
6. Japour AJ, Mayers DL, Johnson VA, et al.: Standardized periph-
patients receiving didanosine and hydroxyurea combination
eral blood mononuclear cell culture assay for determination
therapy. J Infect Dis 1997, 176:899–903.
of drug susceptibilities of clinical human immunodeficiency
16. Lin PF, Samanta H, Rose RE, et al.: Genotypic and phenotypic
virus type 1 isolates. The RV-43 Study Group, the AIDS
analysis of human immunodeficiency virus type 1 isolates
Clinical Trials Group Virology Committee Resistance Working
from patients on prolonged stavudine therapy. J Infect Dis
Group. Antimicrob Agents Chemother 1993, 37:1095–1101.
7. Kaye S, Loveday C, Tedder RS: A microtitre format point muta-
17. Deminie CA, Bechtold CM, Riccardi K, et al.: Clinical HIV-1
tion assay: application to the detection of drug resistance in
isolates remain sensitive to stavudine following prolonged
human immunodeficiency virus type-1 infected patients
therapy [letter]. AIDS 1998, 12:110–112.
treated with zidovudine. J Med Virol 1992, 37:241–246.
18. Soriano V, Dietrich U, Villalba N, et al.: Lack of emergence of
8. Gingeras TR, Prodanovich P, Latimer T, Guatelli JC, Richman genotypic resistance to stavudine after 2 years of monother-
DD, Barringer KJ: Use of self-sustained sequence replication
apy [letter]. AIDS 1997, 11:696–697.
amplification reaction to analyze and detect mutations in
19. Whitcomb JM, Limoli K, Wrin T, et al.: Phenotypic and geno-
zidovudine-resistant human immunodeficiency virus. J Infect
typic analysis of stavudine (d4T) resistant isolates of HIV-1.
Dis 1991, 164:1066–1074.
Second International Workshop on HIV Drug Resistance and 9. Stuyver L, Wyseur A, Rombout A, et al.: Line probe assay for
Treatment Strategies. Lake Maggiore, June 1998 [abstract 58].
rapid detection of drug-selected mutations in the human
20. Human Retroviruses and AIDS 1997. Edited by Korber B, Foley immunodeficiency virus type 1 reverse transcriptase gene.
B, Leitner T, et al.: Los Alamos, New Mexico, USA: Theoretical Antimicrob Agents Chemother 1997, 41:284–291.
Biology and Biophysics, Los Alamos National Laboratory; 1997.

Source: https://www.amsterdamcohortstudies.org/data/99223954/fulltext99223954.pdf